View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5872-3 (Length: 60)

Name: Solexa-NF5872-3
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5872-3
Solexa-NF5872-3
[»] chr5 (1 HSPs)
chr5 (8-60)||(2777852-2777904)
[»] chr4 (2 HSPs)
chr4 (8-60)||(55320505-55320557)
chr4 (7-56)||(31951609-31951658)


Alignment Details
Target: chr5 (Bit Score: 45; Significance: 2e-17; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 2777852 - 2777904
Alignment:
8 gaattttatattgggcttaagccatgatgagaacaattgggcaggtttgtgat 60  Q
    ||||| |||||||||||||||| ||||||||||||||||||||||||||||||    
2777852 gaattatatattgggcttaagcaatgatgagaacaattgggcaggtttgtgat 2777904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 45; Significance: 2e-17; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 8 - 60
Target Start/End: Complemental strand, 55320557 - 55320505
Alignment:
8 gaattttatattgggcttaagccatgatgagaacaattgggcaggtttgtgat 60  Q
    ||||| |||||||||||||||| ||||||||||||||||||||||||||||||    
55320557 gaattatatattgggcttaagcaatgatgagaacaattgggcaggtttgtgat 55320505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 7 - 56
Target Start/End: Complemental strand, 31951658 - 31951609
Alignment:
7 agaattttatattgggcttaagccatgatgagaacaattgggcaggtttg 56  Q
    |||||| |||||||||||||||| |||||| |||||||||||||||||||    
31951658 agaattatatattgggcttaagcaatgatgtgaacaattgggcaggtttg 31951609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University