View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5872-31 (Length: 109)
Name: Solexa-NF5872-31
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5872-31 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 6e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 6e-53
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 28607729 - 28607837
Alignment:
| Q |
1 |
gagatgaatgggatggtaaccaattagtctttgtggtgatgggactttttgttttctcatacataacagatattcttggtacacatgacgttgttggtgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28607729 |
gagatgaatgggatggtaaccaattagtctttgtggtgatgggactttttgttttctcatacataactgatattcttggtacacatgacgttgttggtgc |
28607828 |
T |
|
| Q |
101 |
atttgtata |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
28607829 |
atttgtata |
28607837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.0000000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.0000000000006
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 13659104 - 13659209
Alignment:
| Q |
1 |
gagatgaatgggatggtaaccaattagtctttgtggtgatgggactttttgttttctcatacataacagatattcttggtacacatgacgttgttggtgc |
100 |
Q |
| |
|
||||||||||| | | ||| ||||| ||||| | |||||||| ||||||||| ||||| |||||||||||||||||| ||||| ||| ||||||| || |
|
|
| T |
13659104 |
gagatgaatggaacgataaagaattactctttcttgtgatggggatttttgtttgctcatgcataacagatattcttggaacacaagacattgttggggc |
13659203 |
T |
|
| Q |
101 |
atttgt |
106 |
Q |
| |
|
||||| |
|
|
| T |
13659204 |
ttttgt |
13659209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 13651618 - 13651702
Alignment:
| Q |
1 |
gagatgaatgggatggtaaccaattagtctttgtggtgatgggactttttgttttctcatacataacagatattcttggtacaca |
85 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||| | ||||||| | ||||||| |||||| ||||||| ||||||||| ||||| |
|
|
| T |
13651618 |
gagatgaatgggatgataaacaattactctttcttctgatggggatgtttgtttgctcatatataacaggtattcttggcacaca |
13651702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 37; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 439174 - 439078
Alignment:
| Q |
1 |
gagatgaatgggatggtaaccaattagtctttgtggtgatgggactttttgttttctcatacataacagatattcttggtacacatgacgttgttgg |
97 |
Q |
| |
|
||||||||||||||| ||||||| |||| ||||| | ||||| ||| | |||||||||| |||| | |||| |||||| |||||||| |||||||| |
|
|
| T |
439174 |
gagatgaatgggatgctaaccaactagtttttgtctttatgggccttatggttttctcattcatagccgatactcttggcacacatgatgttgttgg |
439078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University