View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5872-39 (Length: 41)
Name: Solexa-NF5872-39
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5872-39 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 34; Significance: 0.00000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.00000000004
Query Start/End: Original strand, 8 - 41
Target Start/End: Complemental strand, 4263099 - 4263066
Alignment:
| Q |
8 |
ctaggagtcaaccctcctgtctatgaggttgatc |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4263099 |
ctaggagtcaaccctcctgtctatgaggttgatc |
4263066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University