View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5872-6 (Length: 169)

Name: Solexa-NF5872-6
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5872-6
Solexa-NF5872-6
[»] chr7 (2 HSPs)
chr7 (8-169)||(3649891-3650049)
chr7 (8-56)||(3658102-3658149)


Alignment Details
Target: chr7 (Bit Score: 140; Significance: 1e-73; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 8 - 169
Target Start/End: Original strand, 3649891 - 3650049
Alignment:
8 tatgaactaccttgagtcttgattttcaaatgatacgagactttttggtgtaccggaatagtctcctacgtgggaggattacattacaattgtttgtgaa 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   || |||||||||||||||||||    
3649891 tatgaactaccttgagtcttgattttcaaatgatacgagactttttggtgtaccggaatagtctcctacgtggga---ttgcattacaattgtttgtgaa 3649987  T
108 aaataaataaatttatactatgacataaatttatcttatgctagtgtttggaacaggttgtg 169  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
3649988 aaataaataaatttatactatgacataaatttatcttatgcaagtgtttggaacaggttgtg 3650049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.0000000009
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 3658102 - 3658149
Alignment:
8 tatgaactaccttgagtcttgattttcaaatgatacgagactttttggt 56  Q
    ||||||||||||| ||||| ||||||||||| |||||||||||||||||    
3658102 tatgaactacctt-agtctcgattttcaaataatacgagactttttggt 3658149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University