View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5873-25 (Length: 127)
Name: Solexa-NF5873-25
Description: NF5873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5873-25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 8e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 8e-57
Query Start/End: Original strand, 7 - 125
Target Start/End: Original strand, 9905545 - 9905663
Alignment:
| Q |
7 |
aagaatttgagttgatatgaaattggtatgagttaatatccttcattttttcataacgatgctattttttatctccgagatttcactactagaaactctc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9905545 |
aagaatttgagttgatatgaaattggtatgagttaatattcttcattttttcataacgatgctattttttatctccgagatttcactactagaaactctc |
9905644 |
T |
 |
| Q |
107 |
gatttttcttccgaaatta |
125 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
9905645 |
gatttttcttccaaaatta |
9905663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University