View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5873-28 (Length: 121)
Name: Solexa-NF5873-28
Description: NF5873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5873-28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 3e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 3e-24
Query Start/End: Original strand, 7 - 83
Target Start/End: Complemental strand, 26849180 - 26849104
Alignment:
| Q |
7 |
atcaactgggtttgttaattaccaaaccttttcttcttttggtgagttttcacactaataacttttgttttaaaaaa |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
26849180 |
atcaactgggtttgttaattaccaaaccttttcttcttttggtgagttttctaactaacgacttttgtttaaaaaaa |
26849104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University