View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5873-29 (Length: 118)
Name: Solexa-NF5873-29
Description: NF5873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5873-29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 1e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 43164926 - 43165042
Alignment:
| Q |
1 |
ttattgtataaacctgaacctctgtagcacgccacagacacctctgattaggtgtgcccaacacacttggcgtgtgacacccgtaaggcacttgactgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43164926 |
ttattgtataaacctgaacctctgtagcacgccacagacacctctgattaggtgtgcccaacacacttggcgtgtgacacccgtaaggaacttgactgac |
43165025 |
T |
|
| Q |
101 |
attcagacaagttcctc |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43165026 |
attcagacaagttcctc |
43165042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 43222854 - 43222821
Alignment:
| Q |
1 |
ttattgtataaacctgaacctctgtagcacgcca |
34 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
43222854 |
ttatagtataaacctgaacctctgtagcacgcca |
43222821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University