View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5873-30 (Length: 113)
Name: Solexa-NF5873-30
Description: NF5873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5873-30 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 9e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 9e-46
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 9714860 - 9714972
Alignment:
| Q |
1 |
atgtagtgcctgaacaaactaaggatttctccttggattcagattattcttggattgaagatgatggtgctcaaccatggtggaaaattacggatagaaa |
100 |
Q |
| |
|
|||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
9714860 |
atgtcgtgcccgaacaaacaaaggatttctccttggattcagattattcttggattgaagatgacggtgctcaaccatggtggaaaactacggatagaaa |
9714959 |
T |
 |
| Q |
101 |
tgaattagctttc |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9714960 |
tgaattagctttc |
9714972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University