View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5873-4 (Length: 216)
Name: Solexa-NF5873-4
Description: NF5873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5873-4 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 7 - 216
Target Start/End: Complemental strand, 30623574 - 30623365
Alignment:
| Q |
7 |
agttcccacgtggagcacggacagtatgcgccggtgggtgagaaagagatggagttggaaggtggtgaaggagattgtgaaagaggggaagagttaatta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30623574 |
agttcccacgtggagcacggacagtatgcgccggtgggtgagaaagagatggagttggaaggtggtgaaggagattgtgaaagaggggaagagttaatta |
30623475 |
T |
|
| Q |
107 |
aattgaaacaaagattggtttcacaagtattggagattgggataatatttcattcagttataattggtgtgactatgggtatgtctcaaaatgtttgtac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30623474 |
aattgaaacaaagattggtttcacaagtattggagattgggataatatttcattcagttataattggtgtgactatgggtatgtctcaaaatgtttgtac |
30623375 |
T |
|
| Q |
207 |
tataaggcct |
216 |
Q |
| |
|
|||||||||| |
|
|
| T |
30623374 |
tataaggcct |
30623365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University