View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5873-9 (Length: 193)
Name: Solexa-NF5873-9
Description: NF5873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5873-9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 6 - 178
Target Start/End: Original strand, 38966677 - 38966848
Alignment:
| Q |
6 |
cacttagatgtgcagaaagtaagttaacttttcgttgctgcgattttatccgttatagttggattgttggttcatattgttttcattctcgcatcttcat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38966677 |
cacttagatgtgcagaaagtaagttaacttttcgttgctgcgattttatccgttatagttg-attgttagttcatattgttttcattctcgcatcttcat |
38966775 |
T |
 |
| Q |
106 |
atagggtgtatatttctagattccaaatccttttcattagtttatatttttgtgctaaatttatgaattaatc |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38966776 |
atagggtgtatatttctagattccaaatccttttcattagtttatatttttgtgctaaatttatgaattaatc |
38966848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University