View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5874-10 (Length: 127)
Name: Solexa-NF5874-10
Description: NF5874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5874-10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 16066393 - 16066353
Alignment:
| Q |
8 |
cctgcaaggattccgtcatgatcattttaagtattttatat |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16066393 |
cctgcaaggattccgtcatgatcattttaagtattttatat |
16066353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University