View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5874-4 (Length: 176)
Name: Solexa-NF5874-4
Description: NF5874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5874-4 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 5e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 5e-67
Query Start/End: Original strand, 4 - 176
Target Start/End: Original strand, 36742296 - 36742468
Alignment:
| Q |
4 |
atgaatgtctttcaaattgactatgcattccaagannnnnnnngttgcatgttatacctgaggaaatgcaggatctattcatagagtcacatgggcaatc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36742296 |
atgaatgtctttcaaattgactatgcattccaagattttttttgttgcatgttatacctgaggaaatgcaggatctattcatggagtcacatgggcaatc |
36742395 |
T |
|
| Q |
104 |
tgcactgagttacattgtttggttttatatgatatcccgcctcatattagcggctccaatcgagggagatcct |
176 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
36742396 |
tgcattgagttacattgtttggttttatatgatatcccatctcatattagtggctccaatcgagggagatcct |
36742468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University