View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5874-7 (Length: 140)
Name: Solexa-NF5874-7
Description: NF5874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5874-7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 1e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 1e-59
Query Start/End: Original strand, 7 - 140
Target Start/End: Complemental strand, 7575018 - 7574886
Alignment:
| Q |
7 |
aagtatggcagggktactactccgcagaaaaatgtgtatttgttgcattgcagtgcaangcttagtgagttaatgttgtatagattatatttctgctgta |
106 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7575018 |
aagtatggcagggttactactccgcagaaaaatgtgtatttgttgcattgtagtgcaa-gattagtgagttaatgttgtatagattatatttctgctgta |
7574920 |
T |
|
| Q |
107 |
ctaaagttggatgattgtgcattgatttatagtg |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7574919 |
ctaaagttggatgattgtgcattgatttatagtg |
7574886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University