View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-22 (Length: 140)
Name: Solexa-NF5875-22
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-22 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 6e-32; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 6e-32
Query Start/End: Original strand, 55 - 140
Target Start/End: Original strand, 29237914 - 29237999
Alignment:
| Q |
55 |
ttaagacaaactctcaatccgctacgtcgagttttggattgcgatttggaaggaatttgattttgtaggacactgcatgtatgcag |
140 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29237914 |
ttaagacaaactctcaatccgctatgtccagttttggattgagatttggaaggaatttgattttgtaggacaatgcatgtatgcag |
29237999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 3 - 56
Target Start/End: Original strand, 29237826 - 29237879
Alignment:
| Q |
3 |
agaccacagtgtttatataatcaatctacagtgctatctcctaacgttactttt |
56 |
Q |
| |
|
|||||||||| |||| |||||||| |||||| | |||| ||||||||||||||| |
|
|
| T |
29237826 |
agaccacagtttttacataatcaacctacagcgttatcccctaacgttactttt |
29237879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University