View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-23 (Length: 139)
Name: Solexa-NF5875-23
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 9e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 9e-65
Query Start/End: Original strand, 2 - 138
Target Start/End: Complemental strand, 51455358 - 51455222
Alignment:
| Q |
2 |
agaagaagacaaattaaggaagaggtatacaatgcattaccgaagattgttggggattgtgtcgatagcgactgtagagaaggatgacgattggaagctc |
101 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51455358 |
agaagaagaaaaattaaggaagaggcatacaatgcattaccgaggattgttggggattgtgtcgatagcgactgtagagaaggatgacgattggaagctc |
51455259 |
T |
 |
| Q |
102 |
aataatctaaacgacgacgacgaaggcggtgaattaa |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51455258 |
aataatctaaacgacgacgacgaaggcggtgaattaa |
51455222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University