View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-24 (Length: 138)
Name: Solexa-NF5875-24
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 5e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 5e-48
Query Start/End: Original strand, 2 - 135
Target Start/End: Complemental strand, 32267548 - 32267413
Alignment:
| Q |
2 |
ccactttattaagaagaatgcaagacatattcaatctcaaattaaaccagtgtgcagactttatagtcaaactaggagcttcaaatgatgatgatctgac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32267548 |
ccactttattaagaagaatgcaagacatattcaatctcaaattaaaccggtgtgcatactttgtagccaaactaggagcttcaaatgatgatgatctgac |
32267449 |
T |
 |
| Q |
102 |
tattcactcc--caccctctagagggccttcttcct |
135 |
Q |
| |
|
|| ||||||| |||| || |||||||||||||||| |
|
|
| T |
32267448 |
taatcactcccacaccatccagagggccttcttcct |
32267413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University