View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-28 (Length: 135)
Name: Solexa-NF5875-28
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 5e-63; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 5e-63
Query Start/End: Original strand, 7 - 132
Target Start/End: Original strand, 7010272 - 7010397
Alignment:
| Q |
7 |
acggttgatgtgttaatttgttgtttgaattgttgtgttttatagaaaggatttgtctaccgtgagaaccacagttcaccaggatactatgatggacgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7010272 |
acggttgatgtgttaatttgttgtttgaattgttgtgttttatagaaaggatttgtctaccgtgagaaccacagttcaccaggatactatgatggacgtt |
7010371 |
T |
|
| Q |
107 |
accggacaatgtggaagttgcctttg |
132 |
Q |
| |
|
|| ||||||||||||||||||||||| |
|
|
| T |
7010372 |
actggacaatgtggaagttgcctttg |
7010397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 39 - 132
Target Start/End: Original strand, 7007226 - 7007319
Alignment:
| Q |
39 |
ttgtgttttatagaaaggatttgtctaccgtgagaaccacagttcaccaggatactatgatggacgttaccggacaatgtggaagttgcctttg |
132 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7007226 |
ttgtgttatatagaaaggatttgtctaccgtgagaaccacagttcaccaggatactatgatggacgttactggacaatgtggaagttgcctttg |
7007319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 71; Significance: 1e-32; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 50 - 132
Target Start/End: Original strand, 1358572 - 1358654
Alignment:
| Q |
50 |
agaaaggatttgtctaccgtgagaaccacagttcaccaggatactatgatggacgttaccggacaatgtggaagttgcctttg |
132 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
1358572 |
agaaaggatttgtgtaccgtgagaaccacagttcaccaggatactatgacggacgttactggacaatgtggaagttgcctttg |
1358654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 50 - 132
Target Start/End: Original strand, 1374124 - 1374206
Alignment:
| Q |
50 |
agaaaggatttgtctaccgtgagaaccacagttcaccaggatactatgatggacgttaccggacaatgtggaagttgcctttg |
132 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
1374124 |
agaaaggatttgtgtaccgtgagaaccacagttcaccaggatactatgacggacgttactggacaatgtggaagttgcctttg |
1374206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 50 - 132
Target Start/End: Original strand, 1394671 - 1394753
Alignment:
| Q |
50 |
agaaaggatttgtctaccgtgagaaccacagttcaccaggatactatgatggacgttaccggacaatgtggaagttgcctttg |
132 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
1394671 |
agaaaggatttgtgtaccgtgagaaccacagttcaccaggatactatgacggacgttactggacaatgtggaagttgcctttg |
1394753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 67; E-Value: 4e-30
Query Start/End: Original strand, 50 - 132
Target Start/End: Original strand, 1350666 - 1350748
Alignment:
| Q |
50 |
agaaaggatttgtctaccgtgagaaccacagttcaccaggatactatgatggacgttaccggacaatgtggaagttgcctttg |
132 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
1350666 |
agaaaggatttgtgtaccgtgagaaccacagttcaccaggatattatgacggacgttactggacaatgtggaagttgcctttg |
1350748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 67; E-Value: 4e-30
Query Start/End: Original strand, 50 - 132
Target Start/End: Original strand, 1384320 - 1384402
Alignment:
| Q |
50 |
agaaaggatttgtctaccgtgagaaccacagttcaccaggatactatgatggacgttaccggacaatgtggaagttgcctttg |
132 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
1384320 |
agaaaggatttgtgtaccgtgagaaccacagttcaccaggatattatgacggacgttactggacaatgtggaagttgcctttg |
1384402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 67; E-Value: 4e-30
Query Start/End: Original strand, 50 - 132
Target Start/End: Original strand, 1390425 - 1390507
Alignment:
| Q |
50 |
agaaaggatttgtctaccgtgagaaccacagttcaccaggatactatgatggacgttaccggacaatgtggaagttgcctttg |
132 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
1390425 |
agaaaggatttgtgtaccgtgagaaccacagttcaccaggatattatgacggacgttactggacaatgtggaagttgcctttg |
1390507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University