View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-29 (Length: 135)
Name: Solexa-NF5875-29
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-29 |
 | |
|
| [»] scaffold0137 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0137 (Bit Score: 78; Significance: 1e-36; HSPs: 1)
Name: scaffold0137
Description:
Target: scaffold0137; HSP #1
Raw Score: 78; E-Value: 1e-36
Query Start/End: Original strand, 4 - 85
Target Start/End: Complemental strand, 5125 - 5044
Alignment:
| Q |
4 |
aggtatatggctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattattttgtcttacaaggctgcacagg |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5125 |
aggtatatggctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattatcttgtcttacaaggctgcacagg |
5044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 78; Significance: 1e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 1e-36
Query Start/End: Original strand, 4 - 85
Target Start/End: Complemental strand, 3898794 - 3898713
Alignment:
| Q |
4 |
aggtatatggctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattattttgtcttacaaggctgcacagg |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3898794 |
aggtatatggctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattatcttgtcttacaaggctgcacagg |
3898713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 46283487 - 46283571
Alignment:
| Q |
1 |
cataggtatatggctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattattttgtcttacaaggctgcacagg |
85 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||| |||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
46283487 |
cataggtatttggctgagtttaagattggtgatgagaaaaaatctgctgctgaggatactatgttgtcttacaaagctgcacagg |
46283571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University