View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5875-31 (Length: 132)

Name: Solexa-NF5875-31
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5875-31
Solexa-NF5875-31
[»] chr4 (2 HSPs)
chr4 (2-132)||(27725906-27726036)
chr4 (13-85)||(27737651-27737723)


Alignment Details
Target: chr4 (Bit Score: 107; Significance: 5e-54; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 5e-54
Query Start/End: Original strand, 2 - 132
Target Start/End: Complemental strand, 27726036 - 27725906
Alignment:
2 actagcaagggattgagattaattgacagtttgaatataagttgttgtcccaaatagagtaggatccattgcaaatcttgaccagtaatgttgaatgctc 101  Q
    |||||||||  |||||||||||||||||||||| ||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27726036 actagcaagttattgagattaattgacagtttgcatataagttgaggtcccaaatagagtaggatccattgcaaatcttgaccagtaatgttgaatgctc 27725937  T
102 ctcaattccatcaccagtaacatgtattgaa 132  Q
    |||||||||||||||||||||||| ||||||    
27725936 ctcaattccatcaccagtaacatgcattgaa 27725906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 13 - 85
Target Start/End: Complemental strand, 27737723 - 27737651
Alignment:
13 attgagattaattgacagtttgaatataagttgttgtcccaaatagagtaggatccattgcaaatcttgacca 85  Q
    ||||||||| |||| ||||||| ||||||||||   |||||||||||||||||||||||||||||||||||||    
27737723 attgagatttattgtcagtttgcatataagttgagatcccaaatagagtaggatccattgcaaatcttgacca 27737651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University