View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-31 (Length: 132)
Name: Solexa-NF5875-31
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-31 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 5e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 5e-54
Query Start/End: Original strand, 2 - 132
Target Start/End: Complemental strand, 27726036 - 27725906
Alignment:
| Q |
2 |
actagcaagggattgagattaattgacagtttgaatataagttgttgtcccaaatagagtaggatccattgcaaatcttgaccagtaatgttgaatgctc |
101 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27726036 |
actagcaagttattgagattaattgacagtttgcatataagttgaggtcccaaatagagtaggatccattgcaaatcttgaccagtaatgttgaatgctc |
27725937 |
T |
 |
| Q |
102 |
ctcaattccatcaccagtaacatgtattgaa |
132 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |
|
|
| T |
27725936 |
ctcaattccatcaccagtaacatgcattgaa |
27725906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 13 - 85
Target Start/End: Complemental strand, 27737723 - 27737651
Alignment:
| Q |
13 |
attgagattaattgacagtttgaatataagttgttgtcccaaatagagtaggatccattgcaaatcttgacca |
85 |
Q |
| |
|
||||||||| |||| ||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27737723 |
attgagatttattgtcagtttgcatataagttgagatcccaaatagagtaggatccattgcaaatcttgacca |
27737651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University