View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-32 (Length: 130)
Name: Solexa-NF5875-32
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 7 - 126
Target Start/End: Original strand, 35834355 - 35834474
Alignment:
| Q |
7 |
acggttcttataattaactttcccctacatttaggtgaagcaagagaaaaagaagcatgcaatggaattactacgatcactcactcggtcaaggagaaaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35834355 |
acggttcttataattaactttcccctacatttaggtgaagcaagagaaaaagaagcatgcaatggaattactacgatcactcactcggtcaaggaaaaaa |
35834454 |
T |
|
| Q |
107 |
tatgaagatatgcttaccaa |
126 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
35834455 |
tatgaagatatgcttaccaa |
35834474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University