View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-34 (Length: 128)
Name: Solexa-NF5875-34
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-34 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] scaffold0137 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 13 - 128
Target Start/End: Complemental strand, 3896964 - 3896849
Alignment:
| Q |
13 |
gaacaaaggcctattcttatcaaatgctttatgtgtctctcttttctgttcatgtttggcttgtacatgtactgaatcaattttcttttccttgttgata |
112 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3896964 |
gaacaaagacctattcttatcaaatgctttatgtgtctctcttttctgttcatgtttggcttgtacatgtactgaatcaattttcttttccttgttgata |
3896865 |
T |
|
| Q |
113 |
ggctttagatgaagca |
128 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3896864 |
ggctttagatgaagca |
3896849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0137 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: scaffold0137
Description:
Target: scaffold0137; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 13 - 128
Target Start/End: Complemental strand, 4618 - 4503
Alignment:
| Q |
13 |
gaacaaaggcctattcttatcaaatgctttatgtgtctctcttttctgttcatgtttggcttgtacatgtactgaatcaattttcttttccttgttgata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
4618 |
gaacaaaggcctattcttatcaaatgctttatgtgtctctcttttctgttcatgtttggcttgtacttgtactgaatcaattttattttccttgttgata |
4519 |
T |
|
| Q |
113 |
ggctttagatgaagca |
128 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4518 |
ggctttagatgaagca |
4503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University