View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-38 (Length: 127)
Name: Solexa-NF5875-38
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-38 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 1e-32; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 36342865 - 36342745
Alignment:
| Q |
8 |
gattaagggtgttcgaacacttgagtttcaattatttgttcaatattatagnnnnnnnnnn-atggctttatctaattcttatcataatatgttctgttt |
106 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
36342865 |
gattaagggtgttctaacacttgagtttcaattatttgttcaatattatagtttttttttttatgtctttatctaatttttatcataatatgttctgttt |
36342766 |
T |
 |
| Q |
107 |
cttataatgaactaatgtact |
127 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36342765 |
cttataatgaactaatgtact |
36342745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University