View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-40 (Length: 127)
Name: Solexa-NF5875-40
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-40 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 8e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 8 - 127
Target Start/End: Original strand, 51455082 - 51455201
Alignment:
| Q |
8 |
ggctctatctttctggatatctaacactgtctactccgtcaacctcgttaccgatccttctctcactctctttctcatttcggtaacctacctaccatct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51455082 |
ggctctatctttctggatatctaacactgtctactccgtcaacctcgttaccgatccttctctcactctctttctcatttcggtaacctacctaccatct |
51455181 |
T |
|
| Q |
108 |
ctttctattttcttttattc |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
51455182 |
ctttctattttcttttattc |
51455201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University