View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-41 (Length: 124)
Name: Solexa-NF5875-41
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-41 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 2e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 8 - 124
Target Start/End: Original strand, 27725013 - 27725129
Alignment:
| Q |
8 |
ctgtggatgctttactatgggaaaatgtaatgcaccttcctccaagaagattgttgagcaggtagcgctctcgtttctttgctagcaaactaactttgat |
107 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
27725013 |
ctgtggaagctttattatgggaaaatgtaatgcaccttcctccaagaagattgttgagcaggtagagctctcgtttctttgctagcaaactaactttggt |
27725112 |
T |
 |
| Q |
108 |
catgtttggattaacgg |
124 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
27725113 |
catgtttggattaacgg |
27725129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University