View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-43 (Length: 121)
Name: Solexa-NF5875-43
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-43 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 8e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 8e-28
Query Start/End: Original strand, 59 - 121
Target Start/End: Complemental strand, 54478509 - 54478447
Alignment:
| Q |
59 |
ttatattgaagacaagcagatagcacttgtttggttctacgaggatgcagatcaagatgttag |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54478509 |
ttatattgaagacaagcagatagcacttgtttggttctacgaggatgcagatcaagatgttag |
54478447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 54478590 - 54478530
Alignment:
| Q |
8 |
gcaatagattgtagttaattggaaacaaattccaaatattatgatgaagctttatattgaa |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54478590 |
gcaatagattgtagttaattggaaacaaattccaaatattatgatgaagctttatattgaa |
54478530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 63 - 116
Target Start/End: Complemental strand, 44590293 - 44590240
Alignment:
| Q |
63 |
attgaagacaagcagatagcacttgtttggttctacgaggatgcagatcaagat |
116 |
Q |
| |
|
|||||||| ||| ||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
44590293 |
attgaagataaggagacagcacttgtttggtgctacgaggatgcagatccagat |
44590240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University