View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-44 (Length: 120)
Name: Solexa-NF5875-44
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-44 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 7e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 7e-62
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 40205825 - 40205944
Alignment:
| Q |
1 |
gagagaagaagggggctgaagctggtggggttggttttattgggtcatgttgtatagcaactatcttattaatttcaggatgtgatgtgctgatcatgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40205825 |
gagagaagaagggggctgaagctggtggggttggttttattgggtcatgttgtatagcaactatcttattaatttcaggatgtgatgtgctgatcatgga |
40205924 |
T |
 |
| Q |
101 |
tgggacttcccatctatgcc |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40205925 |
tgggacttcccatctatgcc |
40205944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University