View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-48 (Length: 94)
Name: Solexa-NF5875-48
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-48 |
 | |
|
| [»] scaffold0878 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 9e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 9e-30
Query Start/End: Original strand, 8 - 81
Target Start/End: Complemental strand, 27891854 - 27891781
Alignment:
| Q |
8 |
gaaccctgagcttcaactcctccgtcgctctccacagcttcctcgccgtctccctccatcccttacacaccttc |
81 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27891854 |
gaaccctaagcttcaactcctccgtcgctttccacagcttcctcgccgtctccctccatcccttacacaccttc |
27891781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 9e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 9e-30
Query Start/End: Original strand, 8 - 81
Target Start/End: Complemental strand, 31329397 - 31329324
Alignment:
| Q |
8 |
gaaccctgagcttcaactcctccgtcgctctccacagcttcctcgccgtctccctccatcccttacacaccttc |
81 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31329397 |
gaaccctaagcttcaactcctccgtcgctttccacagcttcctcgccgtctccctccatcccttacacaccttc |
31329324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0878 (Bit Score: 55; Significance: 3e-23; HSPs: 1)
Name: scaffold0878
Description:
Target: scaffold0878; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 8 - 82
Target Start/End: Complemental strand, 2541 - 2467
Alignment:
| Q |
8 |
gaaccctgagcttcaactcctccgtcgctctccacagcttcctcgccgtctccctccatcccttacacaccttca |
82 |
Q |
| |
|
||||||| ||||||||||||||| || || ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2541 |
gaaccctaagcttcaactcctccatctctttccacaggttcctcgccgtctccctccatcccttacacaccttca |
2467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 28; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 81
Target Start/End: Original strand, 15115622 - 15115657
Alignment:
| Q |
46 |
ttcctcgccgtctccctccatcccttacacaccttc |
81 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
15115622 |
ttcctcgtcgtctccttccatcccttacacaccttc |
15115657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University