View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-49 (Length: 94)
Name: Solexa-NF5875-49
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-49 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 1e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 31559689 - 31559596
Alignment:
| Q |
1 |
gaagcaaccagctgaaaatttactgtcaatgcatatataattactactccatatactgctttttctaataaaaaagtagaagaaatagatcata |
94 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31559689 |
gaagtaaccagctgaaaatttactgtcaatgcatatataattactactccatatactgctttttctaataaaaaagtagaagaaaaagatcata |
31559596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 31556688 - 31556610
Alignment:
| Q |
1 |
gaagcaaccagctgaaaatttactgtcaatgcatatataattactactc----catatactgctttttctaataaaaaa |
75 |
Q |
| |
|
|||| ||||||||||||||||| |||||||| ||||||||||| | || |||||||||| ||||||||||||||| |
|
|
| T |
31556688 |
gaagtaaccagctgaaaatttattgtcaatgtatatataattataattccatgcatatactgccttttctaataaaaaa |
31556610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University