View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-51 (Length: 76)
Name: Solexa-NF5875-51
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-51 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr4 (6 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 64; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 1e-28
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 16749668 - 16749743
Alignment:
| Q |
1 |
gaaacagagagcaatatgcaaaacactttttcagataaaagggtagatgatcataacttagtttgataagttgaaa |
76 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16749668 |
gaaacaaagagcaaaatgcaaagcactttttcagataaaagggtagatgatcataacttagtttgataagttgaaa |
16749743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.00000000000009; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.00000000000009
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 7482731 - 7482673
Alignment:
| Q |
18 |
gcaaaacactttttcagataaaagggtagatgatcataacttagtttgataagttgaaa |
76 |
Q |
| |
|
||||| |||||||||| || ||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7482731 |
gcaaagcactttttcaaatgaaatggtagatgatcataacttagtttgataagctgaaa |
7482673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 7528864 - 7528795
Alignment:
| Q |
1 |
gaaacagagagcaatatgcaaaacactttttcagataaaagggtagatgatcataacttagtttgataag |
70 |
Q |
| |
|
|||||| ||| ||| | ||||| |||||||||| || ||| ||||||||||||||||||||||||||||| |
|
|
| T |
7528864 |
gaaacaaagaacaaaaagcaaagcactttttcaaatgaaatggtagatgatcataacttagtttgataag |
7528795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 7721664 - 7721733
Alignment:
| Q |
1 |
gaaacagagagcaatatgcaaaacactttttcagataaaagggtagatgatcataacttagtttgataag |
70 |
Q |
| |
|
|||||| ||| ||| | ||||| |||||||||| || ||| ||||||||||||||||||||||||||||| |
|
|
| T |
7721664 |
gaaacaaagaacaaaaagcaaagcactttttcaaatgaaatggtagatgatcataacttagtttgataag |
7721733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 7128407 - 7128459
Alignment:
| Q |
18 |
gcaaaacactttttcagataaaagggtagatgatcataacttagtttgataag |
70 |
Q |
| |
|
||||| |||||||||| || ||| ||||||||||||||||||||||||||||| |
|
|
| T |
7128407 |
gcaaagcactttttcaaatgaaatggtagatgatcataacttagtttgataag |
7128459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 7495130 - 7495078
Alignment:
| Q |
18 |
gcaaaacactttttcagataaaagggtagatgatcataacttagtttgataag |
70 |
Q |
| |
|
||||| |||||||||| || ||| ||||||||||||||||||||||||||||| |
|
|
| T |
7495130 |
gcaaagcactttttcaaatgaaatggtagatgatcataacttagtttgataag |
7495078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 7520797 - 7520745
Alignment:
| Q |
18 |
gcaaaacactttttcagataaaagggtagatgatcataacttagtttgataag |
70 |
Q |
| |
|
||||| |||||||||| || ||| ||||||||||||||||||||||||||||| |
|
|
| T |
7520797 |
gcaaagcactttttcaaatgaaatggtagatgatcataacttagtttgataag |
7520745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University