View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5875-52 (Length: 71)
Name: Solexa-NF5875-52
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5875-52 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 64; Significance: 1e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 1e-28
Query Start/End: Original strand, 8 - 71
Target Start/End: Complemental strand, 24142375 - 24142312
Alignment:
| Q |
8 |
cagataacatcaaaaggacctcgaagaacgagttttgggtggcagtgaattatccttttggatc |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24142375 |
cagataacatcaaaaggacctcgaagaacgagttttgggtggcagtgaattatccttttggatc |
24142312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 4e-19
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 24153947 - 24153888
Alignment:
| Q |
8 |
cagataacatcaaaaggacctcgaagaacgagttttgggtggcagtgaattatccttttg |
67 |
Q |
| |
|
|||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24153947 |
cagataacatcagaaggaactcgaggaacgagttttgggtggcagtgaattatccttttg |
24153888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University