View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-14 (Length: 144)
Name: Solexa-NF5876-14
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 9e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 9e-62
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 81801 - 81944
Alignment:
| Q |
1 |
gtcgagagagatgaaattgataaagaaatgccattacaagaaagataaacaatcggtcatttcaatcaagtgtttttaacccatcaaactcaactcattt |
100 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
81801 |
gtcgagggaaatgaaattgataaagaaatgccattacaagaaagataaacaataggtcatttcaatcaagtgtttttaaccaatcaaactcaactcattt |
81900 |
T |
|
| Q |
101 |
ctttaatcaaataccaagagaagcataaatataaacttgtcgac |
144 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
81901 |
ctttaatcaaatacaaagagaagcataattataaacttgtcgac |
81944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University