View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-17 (Length: 141)
Name: Solexa-NF5876-17
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 5e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 5e-54
Query Start/End: Original strand, 4 - 141
Target Start/End: Complemental strand, 1189433 - 1189300
Alignment:
| Q |
4 |
aggtccaatgaaaatgtgtgttggtctgatggaatctaaattatagagttttata-atcaccgttatttgtcacaagcaatgattatattgactaatact |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1189433 |
aggtccaatgaaaatgtgtgttggtctgatggaatctaaattatagagttttatagatcaccgttatttgtcacaagcaatg-----attgactaatact |
1189339 |
T |
 |
| Q |
103 |
ctggagtaaattttgtgaaattttttagttaaaaatgtg |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1189338 |
atggagtaaattttgtgaaattttttagttaaaaatgtg |
1189300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 112 - 141
Target Start/End: Original strand, 41762223 - 41762252
Alignment:
| Q |
112 |
attttgtgaaattttttagttaaaaatgtg |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41762223 |
attttgtgaaattttttagttaaaaatgtg |
41762252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University