View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5876-17 (Length: 141)

Name: Solexa-NF5876-17
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5876-17
Solexa-NF5876-17
[»] chr2 (1 HSPs)
chr2 (4-141)||(1189300-1189433)
[»] chr4 (1 HSPs)
chr4 (112-141)||(41762223-41762252)


Alignment Details
Target: chr2 (Bit Score: 107; Significance: 5e-54; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 107; E-Value: 5e-54
Query Start/End: Original strand, 4 - 141
Target Start/End: Complemental strand, 1189433 - 1189300
Alignment:
4 aggtccaatgaaaatgtgtgttggtctgatggaatctaaattatagagttttata-atcaccgttatttgtcacaagcaatgattatattgactaatact 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||     |||||||||||||    
1189433 aggtccaatgaaaatgtgtgttggtctgatggaatctaaattatagagttttatagatcaccgttatttgtcacaagcaatg-----attgactaatact 1189339  T
103 ctggagtaaattttgtgaaattttttagttaaaaatgtg 141  Q
     ||||||||||||||||||||||||||||||||||||||    
1189338 atggagtaaattttgtgaaattttttagttaaaaatgtg 1189300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 112 - 141
Target Start/End: Original strand, 41762223 - 41762252
Alignment:
112 attttgtgaaattttttagttaaaaatgtg 141  Q
    ||||||||||||||||||||||||||||||    
41762223 attttgtgaaattttttagttaaaaatgtg 41762252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University