View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-19 (Length: 140)
Name: Solexa-NF5876-19
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-19 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 4e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 4e-64
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 11454496 - 11454635
Alignment:
| Q |
1 |
aagaatgtagatttctcttaataattaaactagaaaatcaaatatcaatcatattaactcaaactatcaattgtgcatgcatataacataatgtagataa |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11454496 |
aagaatgtaaatttctcttaataattaaactagaaaatccaatatcaattatattaactcaaactatcaattgtgcatgcatataacataatgtagataa |
11454595 |
T |
|
| Q |
101 |
ctacttttcatcaataaagtcaactgattaatcacgactc |
140 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11454596 |
ctacttttcatcaataaagtcaaccgattaatcacgactc |
11454635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University