View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5876-20 (Length: 140)

Name: Solexa-NF5876-20
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5876-20
Solexa-NF5876-20
[»] chr5 (1 HSPs)
chr5 (1-140)||(11396193-11396332)
[»] chr4 (2 HSPs)
chr4 (1-140)||(26391754-26391893)
chr4 (1-140)||(46122994-46123133)
[»] chr7 (1 HSPs)
chr7 (1-140)||(7383794-7383933)


Alignment Details
Target: chr5 (Bit Score: 136; Significance: 2e-71; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 136; E-Value: 2e-71
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 11396193 - 11396332
Alignment:
1 gaaccataacctgtcaaaggaaaatttgctgcatcaacagaaaacgaataataggttgcgaattgttgtccatggaggagatcgattgtttgaaacatat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
11396193 gaaccataacctgtcaaaggaaaatttgctgcatcaacagaaaacgaataataggttgcgaattgttgtccatggaggagatggattgtttgaaacatat 11396292  T
101 aggctttcgaaatctcaatttgatggggaggatgtaactt 140  Q
    ||||||||||||||||||||||||||||||||||||||||    
11396293 aggctttcgaaatctcaatttgatggggaggatgtaactt 11396332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 136; Significance: 2e-71; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 136; E-Value: 2e-71
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 26391754 - 26391893
Alignment:
1 gaaccataacctgtcaaaggaaaatttgctgcatcaacagaaaacgaataataggttgcgaattgttgtccatggaggagatcgattgtttgaaacatat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
26391754 gaaccataacctgtcaaaggaaaatttgctgcatcaacagaaaacgaataataggttgcgaattgttgtccatggaggagatggattgtttgaaacatat 26391853  T
101 aggctttcgaaatctcaatttgatggggaggatgtaactt 140  Q
    ||||||||||||||||||||||||||||||||||||||||    
26391854 aggctttcgaaatctcaatttgatggggaggatgtaactt 26391893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 136; E-Value: 2e-71
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 46123133 - 46122994
Alignment:
1 gaaccataacctgtcaaaggaaaatttgctgcatcaacagaaaacgaataataggttgcgaattgttgtccatggaggagatcgattgtttgaaacatat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
46123133 gaaccataacctgtcaaaggaaaatttgctgcatcaacagaaaacgaataataggttgcgaattgttgtccatggaggagatggattgtttgaaacatat 46123034  T
101 aggctttcgaaatctcaatttgatggggaggatgtaactt 140  Q
    ||||||||||||||||||||||||||||||||||||||||    
46123033 aggctttcgaaatctcaatttgatggggaggatgtaactt 46122994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 128; Significance: 1e-66; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 128; E-Value: 1e-66
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 7383794 - 7383933
Alignment:
1 gaaccataacctgtcaaaggaaaatttgctgcatcaacagaaaacgaataataggttgcgaattgttgtccatggaggagatcgattgtttgaaacatat 100  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
7383794 gaaccataacccgtcaaaggaaaatttgctgcatcaacagaaaacgaataataggttgcgaattgttgtccatggaggagatggattgtttgaaacatat 7383893  T
101 aggctttcgaaatctcaatttgatggggaggatgtaactt 140  Q
    ||| ||||||||||||||||||||||||||||||||||||    
7383894 aggttttcgaaatctcaatttgatggggaggatgtaactt 7383933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University