View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-22 (Length: 137)
Name: Solexa-NF5876-22
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-22 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 2e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 20048010 - 20047872
Alignment:
| Q |
1 |
gatgaatgcaatttcatttcttaacgtactcttgtttaactattttagcctaaaaatttctaatgtcaaa--gatatccacaaagatttgtttagttttt |
98 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
20048010 |
gatgaatgcaatttcatttcttaatgtactcttgtttaactattttagcctaaaaatttctaatttcaaaaagatatccacaaagatttgtttagttttt |
20047911 |
T |
|
| Q |
99 |
atccaacaataacctgtgaatgcacaagttatttgttag |
137 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20047910 |
atccaacaataacctttgaatgcacaagttatttgttag |
20047872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 1e-29
Query Start/End: Original strand, 38 - 137
Target Start/End: Original strand, 19904520 - 19904623
Alignment:
| Q |
38 |
aactattttagcctaaaaatttctaatgtcaaa-gata---tccacaaagatttgtttagtttttatccaacaataacctgtgaatgcacaagttatttg |
133 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19904520 |
aactattttagcctaaaaatttctggtgtcaaaagatacaatccacaaagatttggttagtttttatccaacaataacctttgaatgcacaagttatttg |
19904619 |
T |
|
| Q |
134 |
ttag |
137 |
Q |
| |
|
|||| |
|
|
| T |
19904620 |
ttag |
19904623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University