View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-31 (Length: 130)
Name: Solexa-NF5876-31
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-31 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] scaffold1211 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 8e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 8e-59
Query Start/End: Original strand, 12 - 130
Target Start/End: Original strand, 26376678 - 26376796
Alignment:
| Q |
12 |
ttttattaacagcaaactatttattgtttcatttttattgttggtctttcattgttatgatggaaaacatgaaattcaccgctaatggtgattttctgtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26376678 |
ttttattaacagcaaactatttattgtttcatttttattgctggtctttcattgttatgatggaaaacatgaaattcaccgctaatggtgattttctgtt |
26376777 |
T |
|
| Q |
112 |
gttagatcatcaattgatt |
130 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
26376778 |
gttagatcatcaattgatt |
26376796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1211 (Bit Score: 52; Significance: 3e-21; HSPs: 1)
Name: scaffold1211
Description:
Target: scaffold1211; HSP #1
Raw Score: 52; E-Value: 3e-21
Query Start/End: Original strand, 19 - 130
Target Start/End: Original strand, 652 - 763
Alignment:
| Q |
19 |
aacagcaaactatttattgtttcatttttattgttggtctttcattgttatgatggaaaacatgaaattcaccgctaatggtgattttctgttgttagat |
118 |
Q |
| |
|
||||||||| ||| | ||||||||||||||||||| |||||| |||| | |||||||||||| ||||||| |||||| | ||||||||||||||||| |
|
|
| T |
652 |
aacagcaaattatatcatgtttcatttttattgttgatctttctttgtaacgatggaaaacatcaaattcaaaactaatgataattttctgttgttagat |
751 |
T |
|
| Q |
119 |
catcaattgatt |
130 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
752 |
catcaactgatt |
763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University