View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-34 (Length: 128)
Name: Solexa-NF5876-34
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-34 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 2e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 8 - 128
Target Start/End: Original strand, 27668670 - 27668790
Alignment:
| Q |
8 |
taaataaatcttgcttgtggaagttggaattaaatgtcaaggatgtaattttttagtcggatgccaagttcgtggttgatagttcccattcttcttcggt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27668670 |
taaataaatcttgcttgtggaagttggaattaaatgtcaaggatgtaattttttagtcggatgccaagttcgtggttgatagttcccattcttcttcggt |
27668769 |
T |
|
| Q |
108 |
tgtttgtttttctgagtttag |
128 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27668770 |
tgtttgtttttctgagtttag |
27668790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University