View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-36 (Length: 127)
Name: Solexa-NF5876-36
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 7e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 7e-50
Query Start/End: Original strand, 8 - 111
Target Start/End: Original strand, 32572768 - 32572871
Alignment:
| Q |
8 |
tatttgaggttttctagcctgtaattatgctaactgagctatcttgtgttggttttgattgagtaattaatcttcattataatttatatatatagacctt |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32572768 |
tatttgatgttttctagcctgtaattatgctaactgagctatcttgtgttggttttgattgagtaattaatcttcattataatttatatatatagacctt |
32572867 |
T |
 |
| Q |
108 |
tgct |
111 |
Q |
| |
|
|||| |
|
|
| T |
32572868 |
tgct |
32572871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University