View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-4 (Length: 199)
Name: Solexa-NF5876-4
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-4 |
 | |
|
| [»] scaffold0140 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 138; Significance: 2e-72; HSPs: 2)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 8 - 198
Target Start/End: Original strand, 37047 - 37239
Alignment:
| Q |
8 |
ttcaggtctctcaacattgcttcagcttgagtctctgatggacccccaacagtcatgaccttcttgccttg-aacttttgcaata-ttcttttgacattt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
37047 |
ttcaggtctctcaacattgcttcagcttgactctctgatggacccccaacagtcatgaccttcttgccttgtaacttttgcaatatttcttttgacattt |
37146 |
T |
|
| Q |
106 |
caacaaaccagtaataacatgagttgtgtcatcaataaagtcat-gtggcaatggctggttctgagttgcttcctttggaccacttatgttctg |
198 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || | || |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37147 |
caacaaaccagtaataacatcagttgtgtcatcaa-aatttgatggtggcaatggctggttctgagttgcttcctttagaccacttatgttctg |
37239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 193
Target Start/End: Original strand, 37234 - 37264
Alignment:
| Q |
163 |
gttctgagttgcttcctttggaccacttatg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37234 |
gttctgagttgcttcctttggaccacttatg |
37264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University