View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-43 (Length: 123)
Name: Solexa-NF5876-43
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-43 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 2e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 28879568 - 28879690
Alignment:
| Q |
1 |
agggataggatttgagactgttaaaatgttggcctcaaatggtgtcaaggtgatgctcacagctagagatgagaaaaaaggaaatgaagccattgagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||| |
|
|
| T |
28879568 |
agggataggatttgagactgttaaaatgttggcctcaaatggtgtcaaggtgatgctcacagctagagatgagaaaaaggggaatgaagccattcagaaa |
28879667 |
T |
 |
| Q |
101 |
ttgaaacagtttggtctctctga |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28879668 |
ttgaaacagtttggtctctctga |
28879690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 28884461 - 28884583
Alignment:
| Q |
1 |
agggataggatttgagactgttaaaatgttggcctcaaatggtgtcaaggtgatgctcacagctagagatgagaaaaaaggaaatgaagccattgagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
28884461 |
agggataggatttgagactgttaaaatgttggcctcaaatggtgtcaaggtggtgcttacagctagagatgagaaaaaagggaatgaagccattcagaaa |
28884560 |
T |
 |
| Q |
101 |
ttgaaacagtttggtctctctga |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28884561 |
ttgaaacagtttggtctctctga |
28884583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University