View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-45 (Length: 123)
Name: Solexa-NF5876-45
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-45 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 8 - 123
Target Start/End: Complemental strand, 15960337 - 15960222
Alignment:
| Q |
8 |
cttagatcatttactttcgataatgcgactaatgaagtcaaatacatggctaagtacattaagaccgaagttcaagtcgaggagtatgaccgaaagacgg |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15960337 |
cttagagcatttactttcgataatgcgactaatgaagtcaaatacatggctaagtacattaagaccgaagctcaagtcgaggagtatgaccgaaagacgg |
15960238 |
T |
 |
| Q |
108 |
ggtcatggagatttac |
123 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
15960237 |
gctcatggagatttac |
15960222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University