View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-50 (Length: 119)
Name: Solexa-NF5876-50
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-50 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 7 - 119
Target Start/End: Original strand, 9193814 - 9193926
Alignment:
| Q |
7 |
aagaattcatccgtacaacattaaaacttccacttttactctattaatcaaccataacttgttcccttttctacaacttttcgaatatcatcatcaataa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9193814 |
aagaattcatccgtacaacattaaaacttccacttttactctattaatcaaccataacttgttcccttttctacaacttttcgaatatcatcatcaataa |
9193913 |
T |
 |
| Q |
107 |
tatctctgcttct |
119 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
9193914 |
tatctttgcttct |
9193926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University