View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-52 (Length: 116)
Name: Solexa-NF5876-52
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-52 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 43; Significance: 6e-16; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 6e-16
Query Start/End: Original strand, 74 - 116
Target Start/End: Complemental strand, 15183737 - 15183695
Alignment:
| Q |
74 |
gagttggtataacatcctctaacaaataatcaagtattcaatc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15183737 |
gagttggtataacatcctctaacaaataatcaagtattcaatc |
15183695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.000000009
Query Start/End: Original strand, 8 - 53
Target Start/End: Complemental strand, 15183806 - 15183758
Alignment:
| Q |
8 |
caaaatgaattgcatct---tttgtgttgttttctttcttataattaag |
53 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15183806 |
caaattgaattgcatctaattttgtgttgttttctttcttataattaag |
15183758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University