View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-59 (Length: 71)
Name: Solexa-NF5876-59
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-59 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 2e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 44014700 - 44014630
Alignment:
| Q |
1 |
agcaaaggagatgaaatggtcgattcttttgctgctgagattcagattctcggctacattcggcctaggaa |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44014700 |
agcaaaggagatgaaatggtcgattcttttgctgctgagattcagattctcggctacattcggcataggaa |
44014630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University