View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-6 (Length: 186)
Name: Solexa-NF5876-6
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 8 - 182
Target Start/End: Original strand, 32352884 - 32353058
Alignment:
| Q |
8 |
gttattgttatcataaagattctatccactatattattagtttgtggttaaaataagaaggtataataaatagtgcaatcaaataaaaggttgcatatca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32352884 |
gttattgttatcataaagattctatccactatattattagtttgtggttaaaataagaaggtataataaatagtgcaatcaaataaaaggttgcatatca |
32352983 |
T |
|
| Q |
108 |
atgaggaaagtgtgtcagggcacagctatcattgatctttcttggatgaaattgaaaatattgttcatctctctc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||| |
|
|
| T |
32352984 |
atgaggaaagtgtgtcagggcacagctatcattgatctttcttgtatgaaattgaaaatattgttcttttctctc |
32353058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University