View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-60 (Length: 53)
Name: Solexa-NF5876-60
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-60 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr5 (4 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 48; Significance: 2e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-19
Query Start/End: Original strand, 6 - 53
Target Start/End: Original strand, 30946821 - 30946868
Alignment:
| Q |
6 |
caaacatgaaagtggaaggtcttattattgcttcttgttcatcaggta |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30946821 |
caaacatgaaagtggaaggtcttattattgcttcttgttcatcaggta |
30946868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.0000000000002; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.0000000000002
Query Start/End: Original strand, 12 - 53
Target Start/End: Complemental strand, 9908576 - 9908535
Alignment:
| Q |
12 |
tgaaagtggaaggtcttattattgcttcttgttcatcaggta |
53 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9908576 |
tgaaagtggaaggtcttattattgcttcatgttcatcaggta |
9908535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.00000000005
Query Start/End: Original strand, 12 - 53
Target Start/End: Complemental strand, 9878412 - 9878371
Alignment:
| Q |
12 |
tgaaagtggaaggtcttattattgcttcttgttcatcaggta |
53 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
9878412 |
tgaaagtagaaggtcttattattgctgcttgttcatcaggta |
9878371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.00000000005
Query Start/End: Original strand, 12 - 53
Target Start/End: Complemental strand, 9898351 - 9898310
Alignment:
| Q |
12 |
tgaaagtggaaggtcttattattgcttcttgttcatcaggta |
53 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
9898351 |
tgaaagtagaaggtcttattattgctgcttgttcatcaggta |
9898310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 12 - 53
Target Start/End: Original strand, 9863743 - 9863784
Alignment:
| Q |
12 |
tgaaagtggaaggtcttattattgcttcttgttcatcaggta |
53 |
Q |
| |
|
||||||| |||||||||||||||||||| || |||||||||| |
|
|
| T |
9863743 |
tgaaagtagaaggtcttattattgcttcatgctcatcaggta |
9863784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University