View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5876-8 (Length: 177)
Name: Solexa-NF5876-8
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5876-8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 8 - 177
Target Start/End: Complemental strand, 40130220 - 40130051
Alignment:
| Q |
8 |
taaataacataatacttgtatgaatgttacagaagtattgaaggaaatcaattttcaggctttattcctgaagacatagggaagctgatcaacttagaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40130220 |
taaataacataatacttgtatgaatgttacagaagtattgaaggaaatcaattttcaggctttattcctgaagacatagggaagctgatcaacttagaaa |
40130121 |
T |
 |
| Q |
108 |
aactgtaattcttctgaaactcccgtcttcttattgtaatcatagtctctgcttctttctgtagtgttta |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40130120 |
aactgtaattcttctgaaactcccgtcttcttattgtaatcatagtctctgcttctttctgtagtgttta |
40130051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University