View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5877-11 (Length: 149)
Name: Solexa-NF5877-11
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5877-11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 2e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 46618206 - 46618343
Alignment:
| Q |
1 |
agtagcaaaggaagaagataaattaaattggtgcataaattannnnnnngagagaaaattggtacataattagtaatgtcaaagattagggttaatatcc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46618206 |
agtaacaaaggaagaagataaattaaattggtgcataaattatttttttgagagaaaatt-----------agtaatgtcaaagattagggttaatatcc |
46618294 |
T |
 |
| Q |
101 |
aaagtggggacctttcacgcgacttaatgaaaaaagttgaagcagcgtc |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618295 |
aaagtggggacctttcacgcgacttaatgaaaaaagttgaagcagcgtc |
46618343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University