View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5877-2 (Length: 234)
Name: Solexa-NF5877-2
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5877-2 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 8 - 234
Target Start/End: Complemental strand, 35945785 - 35945559
Alignment:
| Q |
8 |
caagttccgctctacggtggaatatcaattcttggaaatgataccatagaaaacatgaacaatgttgcaatggcaatgaacatagcatttgagctaaaat |
107 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35945785 |
caagttccgctctacggtgggatatcaattcttggaaatgataccatagaaaacatgaacaatgttgcaatggcaatgaacataacatttgagctaaaat |
35945686 |
T |
|
| Q |
108 |
caaaggctgacattttaggagttttgtctacattctatcagacaattggatgtccaatcactctccatgtcaaccaacttggaaaacctcttagtttgat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35945685 |
caaaggctgacattttaggagttttgtctacattctatcagacaattggatgtccaatcactttccatgtcaaccaacttggaaaacctcttagtttgat |
35945586 |
T |
|
| Q |
208 |
agattcatgcgtctacacgtaatttat |
234 |
Q |
| |
|
||||||||| ||||||| ||||||||| |
|
|
| T |
35945585 |
agattcatgtgtctacaagtaatttat |
35945559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 63
Target Start/End: Original strand, 12132845 - 12132879
Alignment:
| Q |
29 |
atatcaattcttggaaatgataccatagaaaacat |
63 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
12132845 |
atatcaattcttggaaatgataacatagaaaacat |
12132879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University