View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5877-24 (Length: 131)
Name: Solexa-NF5877-24
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5877-24 |
 | |
|
| [»] chr1 (4 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 5e-66; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 5e-66
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 8138835 - 8138965
Alignment:
| Q |
1 |
agaaggatgggatgcacatgtcttcatatgccaacttgcaacttgatttgaaagtcaaattgttatgatcaaatttatttttcgtacaatccgttttaag |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8138835 |
agaaggattggatgcacatgtcttcatatgccaacttgcaacttgatttgaaagtcaaattgttatgatcaaatttatttttcgtacaatccgttttaag |
8138934 |
T |
|
| Q |
101 |
taaatgtatcaaaatcaaaatctattataat |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8138935 |
taaatgtatcaaaatcaaaatctattataat |
8138965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 6e-41
Query Start/End: Original strand, 6 - 131
Target Start/End: Complemental strand, 7670824 - 7670696
Alignment:
| Q |
6 |
gatgggatgcacatgtcttcatatgccaacttgcaa-cttgattt-gaaagtcaaattgttatgatcaaatttatttttcgtacaatccgtttt-aagta |
102 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||| ||| | |||||||| ||||| |
|
|
| T |
7670824 |
gatgggatgcacatgccttcatatgccaacttgcaatcttgattttgaaagtccaattgttatgatcaaatttattttttgtatattccgtttttaagta |
7670725 |
T |
|
| Q |
103 |
aatgtatcaaaatcaaaatctattataat |
131 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7670724 |
aatgtatcaaaatcaaaatctattataat |
7670696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 85; E-Value: 6e-41
Query Start/End: Original strand, 6 - 131
Target Start/End: Complemental strand, 7709046 - 7708918
Alignment:
| Q |
6 |
gatgggatgcacatgtcttcatatgccaacttgcaa-cttgattt-gaaagtcaaattgttatgatcaaatttatttttcgtacaatccgtttt-aagta |
102 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||| ||| | |||||||| ||||| |
|
|
| T |
7709046 |
gatgggatgcacatgccttcatatgccaacttgcaatcttgattttgaaagtccaattgttatgatcaaatttattttttgtatattccgtttttaagta |
7708947 |
T |
|
| Q |
103 |
aatgtatcaaaatcaaaatctattataat |
131 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7708946 |
aatgtatcaaaatcaaaatctattataat |
7708918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 57; E-Value: 3e-24
Query Start/End: Original strand, 6 - 96
Target Start/End: Original strand, 7709522 - 7709614
Alignment:
| Q |
6 |
gatgggatgcacatgtcttcatatgccaacttgcaa-cttgattt-gaaagtcaaattgttatgatcaaatttatttttcgtacaatccgttt |
96 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||| ||| | ||||||| |
|
|
| T |
7709522 |
gatgggatgcacatgccttcatatgccaacttgcaatcttgattttgaaagtccaattgttatgatcaaatttattttttgtatattccgttt |
7709614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University